2 ‐ SIM 3 : Fw : 5 ’ ‐ GCCTGCAGCTGAGATGCGGCAGAAGCCGGGGACAGTGATGATGAGG ‐ 3 ’ Rv : 5 ’ ‐ CCTCATCATCACTGTCCCCGGCTTCTGCCGCATCTCAGCTGCAGGC

U2OS and U2OS‐HIS‐SUMO2 cell lines [1] were grown in DMEM supplemented with 10% FCS and penicillin/streptomycin (Life Technologies). SLX4+/+ MEFs and SLX4‐/‐ MEFs [2] were also supplemented with non‐essential AAs. Every cell line was checked for mycoplasma contamination regularly. The result was always negative. mSLX4 was amplified by PCR from pBABE‐mSLX4 [2] and cloned into pDONR207 using a BP reaction (Gateway system, Life Technologies). Subsequently, SIMs were mutated by replacing large hydrophobic residues for alanines by PCR mediated mutagenesis (see primers heading) and checked by sequencing. Later, LR reactions were performed according to the instructions of the manufacturer of the Gateway system (Life Technologies) to transfer the different mSLX4 constructs into pBABE‐ puro‐GFP‐DEST (Figure 2 and 3), pMT2‐HA‐DEST (immunoprecipitation Figure 4) [3] or pDEST‐EGFP‐C1 (for Laser microirradiation Figure 4). The NBS1‐mCherry plasmid was kindly provided by Dr. Jiri Lukas and described and used in [4]. Antibodies used in this paper are the following: Mouse anti‐GFP (11814460001, Roche), Rabbit anti‐BTBD12/SLX4 (A302‐270A, Bethyl), Mouse anti phospho‐H2A.X (05‐636, Milipore), Mouse anti‐SUMO2/3 (ab81371, Abcam), Mouse anti‐XPF (MS‐1381, Thermo), Mouse‐anti MUS81 (IQ285, Immuquest), Mouse anti‐PARP1 (9542, Cell Signaling), Mouse anti‐PML antibody was a kind gift from Dr. R. van Driel (University of Amsterdam) and is described in [5]. Sheep anti‐ mSLX4 antibody is described and used in [2]. Thymidine, Nocodazole and DMSO were obtained from Sigma. CDK1 inhibitor RO‐3306 was from Merck‐Millipore. The PARP inhibitor KU‐0058948 was a kind gift from Mark O’Connor (Astrazeneca) and used at a concentration of 10 μM.